This is a working overview of nootropic, written for readers who want more than a one-paragraph summary but less than a textbook.
This page was last updated on 2026-03-27 and is reviewed periodically as new material appears.
Laboratory work relies on standard behavioral paradigms. Rodents are tested in the elevated plus maze, open field, and passive avoidance tasks, with outcomes compared against diazepam or vehicle controls. Intranasal dosing is used most often because it bypasses first-pass metabolism, though intraperitoneal and intravenous routes also appear in published protocols. Biochemical endpoints include tissue BDNF concentrations, cytokine levels, and monoamine metabolites. Human data are limited to small Russian trials reporting reduced anxiety scores; most were not prospectively registered, and few employed independent outcome assessment.
Measuring peptide exposure inside the brain is technically difficult. Selank is degraded rapidly in plasma, and assays must separate intact peptide from fragments, which favors targeted mass spectrometry over immunoassays alone. Reported half-lives are short, on the order of minutes, so effects observed hours later are attributed to downstream signaling rather than to the parent compound. Blood-brain barrier permeability is debated and rarely quantified directly. Gaps include absent dose-response characterization, inconsistent reporting of purity, and almost no pharmacokinetic data from human participants.
Selank is studied chiefly as an animal-model anxiolytic with proposed secondary effects on memory and immune signaling. Reported mechanisms include modulation of the GABA-A receptor complex, inhibition of enkephalin-degrading enzymes, and shifts in monoamine turnover within limbic structures. Some experiments describe increased expression of brain-derived neurotrophic factor in the hippocampus after repeated dosing. No single molecular target has been confirmed, and the peptide does not bind any receptor with the selectivity typical of a conventional small-molecule drug. Mechanism therefore remains a set of hypotheses rather than an established pathway.
Naming conventions place Selank in the same research family as Semax, another Russian-developed peptide investigated for cognitive effects. The two compounds share a lineage but differ in sequence and in the biological systems proposed as their targets. Semax descends from ACTH fragments, whereas Selank descends from tuftsin. Publications sometimes identify Selank by its full peptide sequence or by laboratory codes rather than one uniform trade name. Because replication outside Russia is limited, reports on its properties are best read alongside the study design and the purity of the material tested.
Selank is a synthetic heptapeptide developed in Russia during the 1990s. Researchers at the Institute of Molecular Genetics of the Russian Academy of Sciences designed it as a stabilized analog of tuftsin, a naturally occurring immunomodulatory tetrapeptide. The compound has been studied primarily for its reported anxiolytic and nootropic effects. It remains largely unknown in Western pharmacology and is not approved as a medicine by major regulators such as the FDA or the EMA.
The primary structure of Selank is Thr-Lys-Pro-Arg-Pro-Gly-Pro, corresponding to the molecular formula C33H57N11O9 and a monoisotopic mass of roughly 751.9 daltons. The N-terminal threonine and the arginine residue in the fourth position are shared with tuftsin, which carries the sequence Thr-Lys-Pro-Arg. The three additional residues at the C-terminus, Pro-Gly-Pro, extend the chain and are associated with greater resistance to enzymatic degradation. This extension also separates Selank from the shorter parent peptide.
| Property | Value | Notes |
|---|---|---|
| Principal proposed target | GABA-A receptor complex | Hypothesis derived mainly from animal pharmacology |
| Common behavioral assay | Elevated plus maze | Rodent test for anxiety-like behavior |
| Reported molecular marker | Hippocampal BDNF expression | Measured by immunoassay or mRNA quantification |
| Typical dosing route | Intranasal | Chosen to reduce first-pass metabolism |
| Reported plasma half-life | Minutes | Based on limited peptide stability data |
Pharmacokinetic data are sparse and largely derived from animal work. After intranasal administration the peptide appears in plasma within minutes, and reported half-lives are short, on the order of minutes to tens of minutes. Degradation proceeds through ordinary proteolytic cleavage into constituent amino acids and smaller fragments. Direct evidence that intact Selank reaches brain tissue in meaningful amounts is limited, and the extent of blood-brain barrier penetration is debated. Some authors argue that fragments, not the parent peptide, carry much of the observed activity.
Published clinical work is concentrated in Russian-language journals and generally involves small samples without independent replication. Systematic reviews in English note the shortage of randomised, placebo-controlled trials and the difficulty of verifying methods from translated reports. Outcome measures vary between studies, which complicates pooling of results. Interest in the compound as a cognitive or anxiolytic agent therefore rests on a thinner evidence base than the volume of citations suggests. Replication in well-powered trials with preregistered endpoints would be needed before firm conclusions about efficacy can be drawn.
Selank is a synthetic heptapeptide with the sequence Thr-Lys-Pro-Arg-Pro-Gly-Pro. It was designed at the Institute of Molecular Genetics of the Russian Academy of Sciences as a structural analogue of tuftsin, a naturally occurring tetrapeptide fragment of the immunoglobulin heavy chain. The added Pro-Gly-Pro tail was intended to slow enzymatic degradation and extend biological activity. In Russia it is registered as an anxiolytic nasal preparation, while regulators elsewhere have not approved it for clinical use.
Proposed mechanisms centre on modulation of the GABAergic system, with reports of altered expression of genes related to GABA-A receptor subunits and changed monoamine turnover. Some studies describe inhibition of enkephalinase, the enzyme that degrades endogenous enkephalins, which may prolong opioid peptide signalling. Effects on brain-derived neurotrophic factor and on cytokine expression have also been reported. These findings come largely from animal models and small human studies, and the precise primary target remains unresolved.
Selank is a synthetic heptapeptide developed in Russia. Its sequence is Thr-Lys-Pro-Arg-Pro-Gly-Pro, a seven-residue chain built around the natural tetrapeptide tuftsin. Researchers at the Institute of Molecular Genetics of the Russian Academy of Sciences first described the compound in the mid-1990s. The design combined the tuftsin core with an added Pro-Gly-Pro tail, a modification intended to extend the molecule's stability in biological fluids. Published work on the peptide has appeared mainly in Russian-language journals.
Reported activity for Selank centers on anxiolytic and nootropic effects. Russian clinical reports describe use in anxiety and in cognitive or attention-related complaints. Most of this evidence comes from studies conducted by the same research groups that developed the peptide. Independent replication in other countries remains limited, and no major Western regulatory agency has approved the compound for any indication. The gap between local reports and external verification is a recurring point in discussions of the peptide.
Tuftsin, the parent structure, is a naturally occurring immunomodulatory tetrapeptide released from the Fc region of immunoglobulin G by spleen enzymes. Selank extends this four-residue sequence with three additional amino acids. The stated rationale is that the added tail slows enzymatic breakdown and may influence receptor interactions. How the full heptapeptide behaves at the molecular level is not firmly established, and proposed mechanisms often involve indirect modulation of neurotransmitter or immune signaling rather than a single defined target.
99Tc, half-life 211 ka, is produced at a yield of about 6% per fission; see also the main fission products page. It is also produced (via the short-lived nuclear isomer technetium-99m) as a decay product of molybdenum-99. Technetium is particularly mobile in the environment as it forms negatively charged pertechnetate-ions (TcO−4, resembling the permanganate anion), and it presents the biggest radiological hazard among the long-lived fission products. Despite being a metal, technetium usually does not form positively charged ions, but technetium halides like technetium hexafluoride exist. TcF6 is a nuisance in uranium enrichment as its boiling point (328.4 K (55.3 °C; 131.4 °F)) is very close to that of uranium hexafluoride (329.6 K (56.5 °C; 133.6 °F)). The issue is known to enrichment facilities because spontaneous fission also yields small amounts of technetium (which will be in secular equilibrium with its parent nuclides in natural uranium) but if fluoride volatility is employed for reprocessing, a significant share of the "uranium" separated by fractional distillation will be contaminated with technetium requiring a further purification step. Technetium-99 is suitable for nuclear transmutation by slow neutrons as it has a sufficient thermal neutron cross section and as it has no known stable isotopes. Under neutron irradiation, Tc-99 forms Tc-100 which quickly decays to stable 100Ru a valuable platinum group metal.
Plant-based milks and derivatives such as soy milk, rice milk, almond milk, coconut milk, hazelnut milk, oat milk, hemp milk, macadamia nut milk, and peanut milk are inherently lactose-free. Low-lactose and lactose-free versions of foods are often available to replace dairy-based foods for those with lactose intolerance.
== Epidemiology == The incidence and prevalence of PMD are unknown, and no studies have yet investigated its prevalence or incidence. However, it is generally agreed that PMD is a very rare condition. Some uncertainty regarding the incidence of PMD may be attributed to its confusion with keratoconus. PMD is not linked to race or age, although most cases present early in life, between 20 and 40 years of age. While PMD is usually considered to affect men and women equally, some studies suggest that it may affect men more frequently. Several diseases have been observed in people with PMD. However, no causal relationships have been established between any of the associated diseases and the pathogenesis of PMD. Such diseases include: chronic open angle glaucoma, retinitis pigmentosa, retinal lattice degeneration, scleroderma, kerato-conjunctivitis, eczema, and hyperthyroidism.
== Use == Once extracted, oil is refined and separated, most easily by distillation, into numerous products for direct use or use in manufacturing, such as gasoline (petrol), diesel and kerosene to asphalt and chemical reagents (ethylene, propylene, butene, acrylic acid, para-xylene) used to make plastics, pesticides and pharmaceuticals. In terms of volume, most petroleum is converted into fuels for combustion engines. In terms of value, petroleum underpins the petrochemical industry, which includes many high value products such as pharmaceuticals and plastics. By volume, 84% of hydrocarbons present in petroleum are converted into fuels.
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
Sources: en.wikipedia.org
=== Minimum wages === In May 2026, the Karnataka government revised minimum wages by approximately 60 percent across 81 scheduled sectors. Under the revised structure, the minimum monthly wage for unskilled workers in the Greater Bengaluru area was reported at ₹23,376, while highly skilled workers were entitled to ₹31,114. Rates elsewhere in Karnataka ranged between ₹19,300 and ₹21,251 depending on location and category. Lad described the revision as a long-standing demand of the labour community and said the revised framework was intended to provide greater economic security to workers in the unorganized and specified sectors.
== See also == List of Lord Lieutenants of West Yorkshire List of High Sheriffs of West Yorkshire The Kingdom of Elmet West Yorkshire Urban Area West Yorkshire Metropolitan Ambulance Service West Yorkshire Regiment (The Prince of Wales's Own) List of ceremonial counties in England by gross value added Listed buildings in West Yorkshire
N-Acetylputrescine (NacPut), also known as monoacetylputrescine, is an endogenous metabolite of putrescine and a precursor and metabolic intermediate in the biosynthesis of γ-aminobutyric acid (GABA) from putrescine. The metabolic pathway is specifically putrescine into N-acetylputrescine by putrescine acetyltransferase (PAT), N-acetylputrescine into N-acetyl-γ-aminobutyraldehyde (N-acetyl-GABAL or N-acetyl-GABA aldehyde) by monoamine oxidase B (MAO-B), N-acetyl-GABAL into N-acetyl-γ-aminobutyric acid (N-acetyl-GABA) by aldehyde dehydrogenase (ALDH), and N-acetyl-GABA into GABA by an unknown deacetylase enzyme. This pathway is a minor alternative pathway to the major and primary pathway in which GABA is synthesized from glutamate. There is also another alternative pathway in which putrescine is converted into GABA with γ-aminobutyraldehyde (GABAL or GABA aldehyde) as an intermediate instead. It has been estimated that about 2 to 3% of GABA is synthesized from putrescine in the mouse brain, whereas in the case of the rat brain, the amount was negligible. In 2021, it was discovered that MAO-B does not mediate dopamine catabolism in the rodent striatum but instead participates in striatal GABA synthesis and that synthesized GABA in turn inhibits dopaminergic neurons in this brain area. It has been found that MAO-B, via the putrescine pathway, importantly mediates GABA synthesis in astrocytes in various brain areas, including in the hippocampus, cerebellum, striatum, cerebral cortex, and substantia nigra pars compacta (SNpc).
Such long, isolated helices can also be detected by other methods, such as dielectric relaxation, flow birefringence, and measurements of the diffusion constant. In stricter terms, these methods detect only the characteristic prolate (long cigar-like) hydrodynamic shape of a helix, or its large dipole moment.
Sources: en.wikipedia.org
Intranasal administration predominates in both animal and human research because it avoids hepatic first-pass metabolism. Injectable and intraperitoneal routes appear in animal work mainly for comparison.
Behavioral endpoints include time spent in open arms of the elevated plus maze and avoidance latencies. Biochemical endpoints include BDNF concentration, cytokine levels, and monoamine metabolite ratios in brain tissue.
Most published studies are small, originate from a limited number of laboratories, and lack independent replication. Dose-response relationships, measured brain exposure, and long-term outcomes are not well characterized.
Selank is a synthetic heptapeptide designed as a stabilized analog of the natural tetrapeptide tuftsin. It has been investigated mainly for anxiolytic and cognitive effects. It is not an approved pharmaceutical in most countries.